Di***ey : CR10562J Meritek | Resistors
CR10562J – 5.6 kOhms ±5% 0.125W, 1/8W Chip Resistor 0805 (2012 Metric) Thick Film from Meritek. Pricing and Availability on millions of electronic ...
Al***ba : Source CR10562J 0805(2012Metric) ic chip Transducers ...
CR10562J 0805(2012Metric) ic chip Transducers Industrial Tantalum Polymer Capacitors, You can get more details about from mobile site on alibaba
Me***ek Electronics : CR Series | SMD Standard Chip Resistor 1~27MΩ
CR Series | SMD Standard Chip Resistor 1~27MΩ ; Resistance, 1Ω~27MΩ ; Power (Watts), 1/20, 1/16, 1/10, 1/8, 1/4, 1/2, 3/4, 1 ; Temperature Coefficient, ±100~± ...
co***ents : Buy CR10-6650-FT or Download Datasheet
Buy up to 7800 pieces of ASJ CR10-6650-FT online and PCC can ship today. PC (PCC) has been one of the industry's leading distributors since 1984.
co***ents : Buy CR10-5113-FT or Download Datasheet
Buy up to 9565 pieces of ASJ CR10-5113-FT online and PCC can ship today. PC (PCC) has been one of the industry's leading distributors since 1984.
Go***e Patents : US20210087568A1 - Modified Guide RNAs for Gene Editing
This disclosure relates to modified guide RNAs having improved in vitro and in vivo activity in gene editing methods.
Br***r Forum : CR104PTY210 Brokers, Distributors & Dealers
Buy or sell CR104PTY210 from electronic stocking brokers, independent distributors and dealers. Trade CR104PTY210 now!
la***kcorp : SemiXS - Lantek Corporation
9796, 9795, CR10562J, MERITEK, 1980, RESISTOR. 9797, 9796, CR10563J, MERITEK, 5000, RESISTOR. 9798, 9797, CR10-5R11FM, UNKNOWN, 4626, RESISTOR.
Ce*** : Table S1
... ATGTAGTCGGAGTATTTCCGGT, CGGAAATACTCCGACTACATTA, CR10562-DNMT1_3106_Hs, 356.25, 32.66, 62 726, DNMT1, 1786, Hs, DNMT1_4654_Hs, 48, 0 ...